NotesFAQContact Us
Search Tips
Back to results
Peer reviewed Peer reviewed
Direct linkDirect link
ERIC Number: EJ959037
Record Type: Journal
Publication Date: 2012-Apr
Pages: 6
Abstractor: As Provided
Reference Count: 32
ISSN: ISSN-0964-2633
Molecular Screening of "MECP2" Gene in a Cohort of Lebanese Patients Suspected with Rett Syndrome: Report on a Mild Case with a Novel Indel Mutation
Corbani, S.; Chouery, E.; Fayyad, J.; Fawaz, A.; El Tourjuman, O.; Badens, C.; Lacoste, C.; Delague, V.; Megarbane, A.
Journal of Intellectual Disability Research, v56 n4 p415-420 Apr 2012
Background: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the "MECP2" gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. Methods: We report here the molecular study of two isoforms, "MECP2_e1" and "MECP2_e2", in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. Results: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. Conclusion: Genotype/phenotype correlation is discussed and the importance of a molecular study of "MECP2" gene in patients with very mild features or a regression after the age of 2 is raised.
Wiley-Blackwell. 350 Main Street, Malden, MA 02148. Tel: 800-835-6770; Tel: 781-388-8598; Fax: 781-388-8232; e-mail:; Web site:
Publication Type: Journal Articles; Reports - Research
Education Level: N/A
Audience: N/A
Language: English
Sponsor: N/A
Authoring Institution: N/A
Identifiers - Location: Lebanon